low density lipoprotein receptor (LDLR) - upstream reference sequence


                                                  .         
                                            -670  aatatttttt    -661

.         .         .         .         .         .         
tggctgtacttttgtgaagattttatttaaattcctgattgatcagtgtctattaggtga    -601

.         .         .         .         .         .         
tttggaataacaatgtaaaaacaatatacaacgaaaggaagctaaaaatctatacacaat    -541

.         .         .         .         .         .         
tcctagaaaggaaaaggcaaatatagaaagtggcggaagttcccaacatttttagtgttt    -481

.         .         .         .         .         .         
tccttttgaggcagagaggacaatggcattaggctattggaggatcttgaaaggctgttg    -421

.         .         .         .         .         .         
ttatccttctgtggacaacaacagcaaaatgttaacagttaaacatcgagaaatttcagg    -361

.         .         .         .         .         .         
aggatctttcagaagatgcgtttccaattttgagggggcgtcagctcttcaccggagacc    -301

.         .         .         .         .         .         
caaatacaacaaatcaagtcgcctgccctggcgacactttcgaaggactggagtgggaat    -241

.         .         .         .         .         .         
cagagcttcacgggttaaaaagccgatgtcacatcggccgttcgaaactcctcctcttgc    -181

.         .         .         .         .         .         
agtgaggtgaagacatttgaaaatcaccccactgcaaactcctccccctgctagaaacct    -121

.         .         .         .         .         .         
cacattgaaatgctgtaaatgacgtgggccccgagtgcaatcgcgggaag \ ccagggtttc -61


Powered by LOVDv.1.1.0 Build 12
©2004-2006 Leiden University Medical Center