low density lipoprotein receptor (LDLR) - 1610 nt intron 17 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .
gtgagtgaccctctctagaaagccagagcccatggcggccccctcccagctggaggcata  2547+60

         .         .         .         .         .         .
tgatcctcaagggaccaggccgaggcttccccagccctccagatcgaggacagcattagg  2547+120

         .         .         .         .         .         .
tgaatgcttctgtgcgctcattcagaatgtcagcggacaatggccttggtggtgtagagg  2547+180

         .         .         .         .         .         .
aatgttggataagcaaatagagagctccatcagatggtgacagggcaaagaaagtcaaaa  2547+240

         .         .         .         .         .         .
ggagttcagaggccgggcgcggtggctcatgcctgtaatcccaggactttgggaggccga  2547+300

         .         .         .         .         .         .
ggctggcggatcacctgaagtcaggagtttgagaccagcttggccatcatgacaaaaccc  2547+360

         .         .         .         .         .         .
cgtctctattaaaaatacaaaaaattagccaggcgtgggagtgggcgcctgtaatcccag  2547+420

         .         .         .         .         .         .
ctactcgggaggccgaggtagaaaaatcgcttgaacctaggaggcagaggttgcagtgag  2547+480

         .         .         .         .         .         .
ccgagatcgcgccactgcattccagcccgggaggcaagagcaaaactccatctcaaaaaa  2547+540

         .         .         .         .         .         .
aaaaaaaaaaggagttcagaggcccggcatggtggttcacacatgtgatcccagaacttg  2547+600

         .         .         .         .         .         .
gggaggttgaggcaggagaatcacctgagctcagagttcaagaccagcctgggcagcaca  2547+660

         .         .         .         .         .         .
gcaagaccccatctctgcaaaaaataaaaatttagcccagtgtggtgatgagcgcctagt  2547+720

         .         .         .         .         .         .
tccagctactagggaggctaaggcaggaggattgcttgaggctaaggtaggagattgaga  2547+780

         .         .     
ctgcagtgacttgtgattgcgtcac  2547+805

--------------------- middle of intron ---------------------
                                        .         .         
                         2548-805  tgcgctccagcctgggtgacagagc  2548-781

.         .         .         .         .         .         
aagcccttgtctcttaaaaaaaaaaaaaaattcaaagaagggtttccagagggccaggag  2548-721

.         .         .         .         .         .         
ggaggaagggagaggaggtgttttatttttttgcttttattttttattttgagacagagt  2548-661

.         .         .         .         .         .         
ctctctctgtcacccaggttggagtgcagtgctgtgatcttggctcactgcaacttctgc  2548-601

.         .         .         .         .         .         
ctcctgggttcaagcaattcttatgcctcagcctcagcctcctgagtagctgggattaca  2548-541

.         .         .         .         .         .         
acactatgcccgggtaatttttgtatttttagtagagacgaggtttcgccatgttgccca  2548-481

.         .         .         .         .         .         
gactggtctcgaactcctgacctcaagtgatccacccgccttggcctccccacgtgctgg  2548-421

.         .         .         .         .         .         
gattgcaggcgtgagccactgcgcccgccttgatctttacacaaggggtttagggtaggt  2548-361

.         .         .         .         .         .         
agccttctctgaaccaggagaacagcctgtgcgaaggccctgaggctggaccgtgcctgt  2548-301

.         .         .         .         .         .         
tgggtttgaggccgttgtagctggagcaaacagagagaggggtaaaaaggcaggaggcta  2548-241

.         .         .         .         .         .         
ccaggcaggttgtgcagagccttgtgggccactggggaggactttggcttttgccctgag  2548-181

.         .         .         .         .         .         
agcggtgggaagtgactgaatccggtactcaccgtctccctctggcggctcctgggggaa  2548-121

.         .         .         .         .         .         
catgcttggggatcaggctgggggaggctgccaggcccaggaggtgagaagtaggtggcc  2548-61

.         .         .         .         .         .         
tccagccgtgtttcctgaatgctggactgatagtttccgctgtttaccatttgttggcag  2548-1


Powered by LOVDv.1.1.0 Build 12
©2004-2006 Leiden University Medical Center