low density lipoprotein receptor (LDLR) - 4663 nt intron 15 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .
gtaaagactgggccctccctaggcccctcttcacccagagacgggtcccttcagtggcca  2311+60

         .         .         .         .         .         .
cgaacattttggtcacgagatggagtccaggtgtcgtcctcactcccttgctgaccttct  2311+120

         .         .         .         .         .         .
ctcacttgggccgtgtgtctctgggccctcagtttccctatctgtaaagtgggtctaata  2311+180

         .         .         .         .         .         .
acagttcttgccctctttgcaaggattaaatgggccaaatcatatgaggggccaggtcct  2311+240

         .         .         .         .         .         .
tcaggctcctggttcccaaagtcagccacgcaccgtgtgggtcccaaaattttatcaagg  2311+300

         .         .         .         .         .         .
cacattcgttgcctcagcttcaggcatctgcccaaaaaggccaggactaaggcaaggaga  2311+360

         .         .         .         .         .         .
gggagggattcctcagtactcagcttttcacagaggctccaaaaggctaaggaatccagt  2311+420

         .         .         .         .         .         .
aacgttttaacacaattttacaatttttttttttgagacggagttttgctcttgttgccc  2311+480

         .         .         .         .         .         .
aggctggagtgcagtggcacgatctcggctcactgcaacctctggctcccgggttcaagc  2311+540

         .         .         .         .         .         .
gattctcctgcctcagtctcccgagtagctgggattacaggcatgcgccaccacgctcgg  2311+600

         .         .         .         .         .         .
ctaattttgtatttttagtacagaaggggcttctctgttggtcaggctggtcgtgaactc  2311+660

         .         .         .         .         .         .
tcaacctcaggtgagccacccgcctgagcctcccaaagtgctgggattacaggtgtgagc  2311+720

         .         .         .         .         .         .
caccacgcctggccttttttttgagacagagtctcgctctcgcccatgctgtactgcagt  2311+780

         .         .         .         .         .         .
gacgcagtctgggctcactgtaacctccgcttcccaggttcaagtgattcttctgccgca  2311+840

         .         .         .         .         .         .
gcctcccatgtagagtagctgggattacaggcacccgccaccatgcctggctaattcttg  2311+900

         .         .         .         .         .         .
catttttagtagagatggggtttcacagtgttggccaggctggtctcaaacttctgacct  2311+960

         .         .         .         .         .         .
caagtcatctgcctgccttggccctgccaaagtgctgggattatagatgtgagccaccgc  2311+1020

         .         .         .         .         .         .
gcctggcctacagtttattctttggtggctcacacctgtaatctcagcactttgggaggc  2311+1080

         .         .         .         .         .         .
caaggtgggagaatggcttgagcccaggagttcaagtccagcctgggcaacatagcaaga  2311+1140

         .         .         .         .         .         .
ccctatctctactacaaaataaataataaataaactaattttttttcttttaaaacccaa  2311+1200

         .         .         .         .         .         .
ctattcaacatggcaatgcaatatattaaaaaaattttttttttctttgaaacggagtct  2311+1260

         .         .         .         .         .         .
ctcactgtcacccgggctggagtgcagtgtcgccatcttggctcactgcaacctccgcct  2311+1320

         .         .         .         .         .         .
cccaggtccaagtgattctcctgcttcagcctcccgagtagctgggattacaggcaccca  2311+1380

         .         .         .         .         .         .
ccaccatacccagctaatatttttgtatttttagtagagatggggtttcactatgttggg  2311+1440

         .         .         .         .         .         .
caggctggtctggaactcctgacctcgtgatctgcccgaggatcggcggcctcccaaagt  2311+1500

         .         .         .         .         .         .
gctggggattgcaggcatgagccaccgtgcccagccaaaacttttttatttttatttttt  2311+1560

         .         .         .         .         .         .
tgggacacggtctcactgtgtaccccagactggagtgatagagtgctgtcatggctcact  2311+1620

         .         .         .         .         .         .
gcagcctcaacctccctgggctcaggtgatcttcctgcttcagtctcccaggtagctggg  2311+1680

         .         .         .         .         .         .
actacaggcatgagccaccacacccagctaatttttgaatttttttgtagagacagggtt  2311+1740

         .         .         .         .         .         .
tcaccttgtggcccagacttgtctctaactccagggctcaagcgatctgcccaccttggc  2311+1800

         .         .         .         .         .         .
ctcccaaagtgctgagattaatgcaatttaaaaaattttttggccaggcctggtggctca  2311+1860

         .         .         .         .         .         .
tgcctgtattcacaacaccttgggaggcaaaggtgggcagatcacttgaggtcaggagtt  2311+1920

         .         .         .         .         .         .
cgagactagcctggccaacatggtgaaaccccctgtctactaaaaaaatacaaaaattac  2311+1980

         .         .         .         .         .         .
ctgggcacagtggtgggtgcctgtaatcccagctacttgggatgctgagggtggagaatt  2311+2040

         .         .         .         .         .         .
gcttgaacctgggaggcagaagttgcagtaagccaagatcatgccactggactccagcct  2311+2100

         .         .         .         .         .         .
cagtgacagagcaaaactctgtctccaaaaaaattgttttttttttttttttttcaaatc  2311+2160

         .         .         .         .         .         .
atcacactacagccaaggcctggccacttacttttgtaaataaagttttattggagccag  2311+2220

         .         .         .         .         .         .
tggaccagtgaggccgaatcttgcaggtgtaagatcacagtctatccttgaaaattttga  2311+2280

         .         .         .         .         .  
tattttgttcattgggtggtttttcattaatttaaattttaaaaaataacat  2311+2332

--------------------- middle of intron ---------------------
          .         .         .         .         .         
         attaaaggctggtgtggaggtgcacgcctgcagtcctagctactcccagag  2312-2281

.         .         .         .         .         .         
gctgaggcgggagacttgcttgagcccaagagttgaagtccagcctgggcaacatagcga  2312-2221

.         .         .         .         .         .         
gacccccatctctaaaaataaaaataatgcattagaatattattggattcctgggcaggg  2312-2161

.         .         .         .         .         .         
cacagtggctcacacctgtaatcccagcactttgggaggctgaggtgggtggatcacctg  2312-2101

.         .         .         .         .         .         
aggtcaggagtttgagaccagcctggccaacatggtgaaaccccgtctctactaaaaata  2312-2041

.         .         .         .         .         .         
caaaaattagccaggcgtggtggcaggtgcctgtaatcccagctactcgggaggctgaag  2312-1981

.         .         .         .         .         .         
cacgagaatcgcttgaatccaggaggcggaggttgcagtgagctgagattgcgccattgc  2312-1921

.         .         .         .         .         .         
actccagcctggaggacaagagtgaaactccattcccctctgcaaagaaaaggaatatta  2312-1861

.         .         .         .         .         .         
tcagattcctaagctttttggctccccctttagtttgggggctggggtggtgagtgtctg  2312-1801

.         .         .         .         .         .         
acctggcctcactgtcctccctggatgtgatgagacccaggtgtgggtcaggatgtcatt  2312-1741

.         .         .         .         .         .         
cgtttgtccaccagagggcgcccaaactgctttgagctgctgggaaatggtgctcctaga  2312-1681

.         .         .         .         .         .         
cttttagcaaacaaacaaaaaaaaatggcacatcggcaaatttcagaccattcttttttt  2312-1621

.         .         .         .         .         .         
ttttttttttggttccagagtagctgaaatctttgttcagttacaagcaggataaaatgg  2312-1561

.         .         .         .         .         .         
aaactgcctgggagaggctgagaaaccttcttgcttgggggaggtggggcactgctagaa  2312-1501

.         .         .         .         .         .         
ttaatcgcttcacagaccagcccatccaggactcctcaaatttggcaaaaaagccattca  2312-1441

.         .         .         .         .         .         
ttcattcattcatttatgtagagacgagggggatctggctatattgcctagattggtctc  2312-1381

.         .         .         .         .         .         
aaattcctggcctcaagtgatcctcctgccttggtctactaatgtgctgcgattacaggc  2312-1321

.         .         .         .         .         .         
atgagccaccgtgcctagctctagtggacttgaaatgttgccttgcccagggcccttatg  2312-1261

.         .         .         .         .         .         
ttgaatggcccaggtccacttgtatggttctgtaccaaggttaaccccatcccataatgc  2312-1201

.         .         .         .         .         .         
ctgggacagttgatgcaggacaatcagcttctgtgccattcaacctcaggactgagcatg  2312-1141

.         .         .         .         .         .         
ctgggcattgtggggtccgaaggtggctcccctgtccccttcaaaataccctctttttct  2312-1081

.         .         .         .         .         .         
tttcttcttttttttttttttttttttttgagacgaagtcttgctctgttgccccagcta  2312-1021

.         .         .         .         .         .         
gagtgcagtggtgcgatctcagctccccgcaacctctgcttcccgggttcaggcgattct  2312-961

.         .         .         .         .         .         
cctgcctcagcctcctgagtagctgggattacaggtgcccaccgccacagctggctaatt  2312-901

.         .         .         .         .         .         
tttgtatttttagtagagacagggtttcaccgtgttggccaggctggtcttgaactcctg  2312-841

.         .         .         .         .         .         
acctcaggcaacctgcccacctcagcctcccaaagtgctgggattacaggtttgagccac  2312-781

.         .         .         .         .         .         
tgggcctggccttttttttttttttttgagagggagtctcactctgttgcccaggctgga  2312-721

.         .         .         .         .         .         
gtgcaatggcgcgatcttgactcactgcaactccatttcccgggttcaagtgattctcct  2312-661

.         .         .         .         .         .         
ccctcagcctcccaagtagctgggattacaggtgcatgccaccacggccagctaattttg  2312-601

.         .         .         .         .         .         
tatttttagtagagacagggtttcactatgttgatcatgctggtctcaaactcctgacct  2312-541

.         .         .         .         .         .         
taggtgatctgcccgccttagcctcccaaagtgttgggattacaggtgtgagccaccgcg  2312-481

.         .         .         .         .         .         
cccagaccaaaatatgctcattttaataaaatgcacaagtaggttgacaagaatttcacc  2312-421

.         .         .         .         .         .         
tgcaaccttgtcaaccacctagaataaaagcctctgcagccctcccctaaagactcatca  2312-361

.         .         .         .         .         .         
atgtgaggctcaagaaccttcttaggctgggctcggtggctcatttctgtaatccctgca  2312-301

.         .         .         .         .         .         
ctttggaaggctgaggcaggaggatctcttgaggccaggagttcaagacaagcctgggca  2312-241

.         .         .         .         .         .         
acatagccagacctctgtttctatcccccacaaaaagaaccttcttaaaccggaattgag  2312-181

.         .         .         .         .         .         
tcctacaacctcgataactcacaaataagcccgtgtggcctctcacagacttgggaagtt  2312-121

.         .         .         .         .         .         
ctccaagtgtccagggagatgtgccaggcgctttcctgccgtgaccaccgtcctctgcct  2312-61

.         .         .         .         .         .         
gctccatttcttggtggccttcctttagacctgggcctcactcttgcttctctcctgcag  2312-1


Powered by LOVDv.1.1.0 Build 12
©2004-2006 Leiden University Medical Center