low density lipoprotein receptor (LDLR) - 136 nt intron 13 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .
gtaagggtgggtcagccccacccccccaaccttgaaacctccttgtggaaactctggaat  1987+60

        
gttctgga  1987+68

--------------------- middle of intron ---------------------
                                                            
                                           1988-68  aatttctg  1988-61

.         .         .         .         .         .         
gaatcttctggtatagctgatgatctcgttcctgccctgactccgcttcttctgccccag  1988-1


Powered by LOVDv.1.1.0 Build 12
©2004-2006 Leiden University Medical Center