low density lipoprotein receptor (LDLR) - 646 nt intron 11 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .
gtatgttcgcaggacagccgtcccagccagggccgggcacaggctggaggacagacgggg  1705+60

         .         .         .         .         .         .
gttgccaggtggctctgggacaagcccaagctgctccctgaaggtttccctctttctttt  1705+120

         .         .         .         .         .         .
ctttgttttttctttttttgagatgaggtcttggtctgtcacccaggctggagtgcactg  1705+180

         .         .         .         .         .         .
gcgcaatcgtagctcactgcagcctccacctcccaggctcaagtgatcctcctgcctcac  1705+240

         .         .         .         .         .         .
cctcctgagtagctgagattacagacacgtgccaccacggcagactaattttattttatt  1705+300

         .         .   
tttgggaagagacaaagtcttgt  1705+323

--------------------- middle of intron ---------------------
                                        .         .         
                           1706-323  tatgttggcctggctggtctcaa  1706-301

.         .         .         .         .         .         
actcagggtgcaagcgatcctcccgcctcagccttccaaactgctgggattacaggcgtg  1706-241

.         .         .         .         .         .         
ggccaccgtacccagcctccttgaagtttttctgacctgcaactcccctacctgcccatt  1706-181

.         .         .         .         .         .         
ggagagggcgtcacaggggaggggttcaggctcacatgtggttggagctgcctctccagg  1706-121

.         .         .         .         .         .         
tgcttttctgctaggtccctggcagggggtcttcctgcccggagcagcgtggccaggccc  1706-61

.         .         .         .         .         .         
tcaggaccctctgggactggcatcagcacgtgacctctccttatccacttgtgtgtctag  1706-1


Powered by LOVDv.1.1.0 Build 12
©2004-2006 Leiden University Medical Center