low density lipoprotein receptor (LDLR) - 85 nt intron 09 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .   
gtgagcgtcgcccctgcctgcagccttggcccgcaggtgagat  1358+43

--------------------- middle of intron ---------------------
                    .         .         .         .         
         1359-42  gagggctcctggcgctgatgcccttctctcctcctgcctcag  1359-1


Powered by LOVDv.1.1.0 Build 12
©2004-2006 Leiden University Medical Center