low density lipoprotein receptor (LDLR) - 1638 nt intron 08 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .
gtgagcacgggaaggcggcgggtgggggcggcctcaccccttgcaggcagcagtggtggg  1186+60

         .         .         .         .         .         .
ggagtttcatcctctgaactttgcacagactcatatcccctgaccgggaggctgtttgct  1186+120

         .         .         .         .         .         .
cctgagggctctggcaggggagtctgccgccctgttaggacttgggcttgccagggggat  1186+180

         .         .         .         .         .         .
gcctgcatatgtcctagtttttgggaatatccagttaacggaaccctcagccctactggt  1186+240

         .         .         .         .         .         .
ggaacaggaaccggctttcctttcagggacaacctggggagtgacttcaaggggttaaag  1186+300

         .         .         .         .         .         .
aaaaaaaattagctgggcatggtgccacacacctgtggtcccagctactcagaaggctga  1186+360

         .         .         .         .         .         .
ggcgggaggattgcttgagggcaggaggattggttgatcctcccacctcagcctccggag  1186+420

         .         .         .         .         .         .
tagctgggacctcaggtgcatgccactatgcctggctaattttcttttttcttttttttt  1186+480

         .         .         .         .         .         .
ttttttcgagacggagtctcgctctgttgcccaggctggagtgcagtggcaggatctcgg  1186+540

         .         .         .         .         .         .
ctcactgcaagctccgcctcccgggttcacgccattctcctgcctcagcctccccagtag  1186+600

         .         .         .         .         .         .
ctgggactacaggagcccgccactgcaccaggccaatttttttgtatttttagtagagac  1186+660

         .         .         .         .         .         .
ggggtttcactgtgttagccaggatggtctcgatctcctgacttcgtgatccgcccacct  1186+720

         .         .         .         .         .         .
cggccttccaaagtgctcggattacaggcgtgagccactgcgcccagccgctaattttca  1186+780

         .         .         .         
tatttttagtaaaaacagggtttcaccatgttggccagg  1186+819

--------------------- middle of intron ---------------------
                              .         .         .         
           1187-819  ctagtcttgaactcctgaacccaagtgatcctcctgcct  1187-781

.         .         .         .         .         .         
tggcctcccaaagtgctgggattacagacaccacacctggctattattattttttagaga  1187-721

.         .         .         .         .         .         
cagggtgctgctctatcttccagcctgtagtgcagtgcagcctccatcatagctcgctgc  1187-661

.         .         .         .         .         .         
agccttgacctcctgggttcacgtgatcgtcccgcctaagcctctggaggagctgggagt  1187-601

.         .         .         .         .         .         
actggcatgtgccaccatgcctggttaatttttttttttttttttttgagacagagtctc  1187-541

.         .         .         .         .         .         
attctgtcacccaggctggagtgcggtggtgcgatcttggcttactgaaacctccacctc  1187-481

.         .         .         .         .         .         
ccaggttccagcaattctcctgcctcacccttctgagtagctgggattacaggttccggc  1187-421

.         .         .         .         .         .         
taccaaacctggctagtttttgtatgtttagtagagacagggtttcaccatgttggtgag  1187-361

.         .         .         .         .         .         
gctggtctcgattctcccgcctcagcctcccaaagtgctgggattacaggcttgagccac  1187-301

.         .         .         .         .         .         
cgtgcctggcttttttttttttttttttttttgtggcaataaggtctcattgtcttgccc  1187-241

.         .         .         .         .         .         
aggctagccttatgctcctagcctcaagtgatcctcctccctcagcctcccaaagtgctg  1187-181

.         .         .         .         .         .         
ggattacaggtgggcgccactgtgcctgttcccgttgggaggtcttttccaccctctttt  1187-121

.         .         .         .         .         .         
tctgggtgcctcctctggctcagccgcaccctgcaggatgacacaaggggatggggaggc  1187-61

.         .         .         .         .         .         
actcttggttccatcgacgggtcccctctgaccccctgacctcgctccccggacccccag  1187-1


Powered by LOVDv.1.1.0 Build 12
©2004-2006 Leiden University Medical Center