low density lipoprotein receptor (LDLR) - 742 nt intron 07 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .
gtgatttccgggtgggactgagccctgggccccctctgcgcttcctgacatggcaaccaa  1060+60

         .         .         .         .         .         .
acccctcatgcctcagtttccccatctgttaagtgtgcttgaaagcagttaggagggttt  1060+120

         .         .         .         .         .         .
catgagattccacctgcatggaaaactatcattggctggccagagtttcttgcctctggg  1060+180

         .         .         .         .         .         .
gattagtaattaagaaatttcaggccgggtgcgtaatccctgtaatcccaacaccttggg  1060+240

         .         .         .         .         .         .
acgccgaggcgggcagatcacctgaggtcgggagttccagaccagcctgaccaacatgga  1060+300

         .         .         .         .         .         .
gaaaccccgtctctactaaaaatacaaaattagccgggcttggtggtgcatgcctataat  1060+360

         . 
cccagctactc  1060+371

--------------------- middle of intron ---------------------
                                                  .         
                                       1061-371  aggaggctgag  1061-361

.         .         .         .         .         .         
gcaggagaatcacttgaacctgggaggtggaggttgtggtgagccaagatcgtgccattg  1061-301

.         .         .         .         .         .         
cactccagcctgggcaacaagagtgaaactccatccaaaaaaaaaagaaaagaaaagaaa  1061-241

.         .         .         .         .         .         
aaaaagaaaagaaatttcagctgacacagcttcacactcttggttgggttcccgtggtga  1061-181

.         .         .         .         .         .         
atgatgaggtcaggtgatgactggggatgacacctggctgtttccttgattacatctccc  1061-121

.         .         .         .         .         .         
gagaggctgggctgtctcctggctgccttcgaaggtgtgggttttggcctgggccccatc  1061-61

.         .         .         .         .         .         
gctccgtctctagccattggggaagagcctccccaccaagcctctttctctctcttccag  1061-1


Powered by LOVDv.1.1.0 Build 12
©2004-2006 Leiden University Medical Center