low density lipoprotein receptor (LDLR) - 3137 nt intron 06 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .
gtgagtctcggtgcaggcggcttgcagagtttgtggggagccaggaaagggactgagaca  940+60

         .         .         .         .         .         .
tgagtgctgtagggttttgggaactccactctgcccaccctgtgcaaagggctccttttt  940+120

         .         .         .         .         .         .
tcattttgagacagtctcgcacggtcgcccaggctggagcgcaatggcgcgatctcggct  940+180

         .         .         .         .         .         .
cactgcaacctctgcctcccaggttcaagtgattctcctgcctcagcctcctgagtagct  940+240

         .         .         .         .         .         .
gggattacaggcgcccaccaccaagcccgggtaattttttgtatgtttagtagagatggg  940+300

         .         .         .         .         .         .
gtttcactatgttggccaggctggtgttgaactcctgacctcatgatccgcccacctcgg  940+360

         .         .         .         .         .         .
cctcccaaagtgctgggattacaggcgtgacccaccccatgaaaaaaaattaaaaaatga  940+420

         .         .         .         .         .         .
agcgatgctgggcgcggtggatcacgcctgtaatcccagcactttgggaagctgaggcag  940+480

         .         .         .         .         .         .
gcagatcacgagggcaggagattgagaccatcctggctaatacggtgaaaccccatctct  940+540

         .         .         .         .         .         .
actaaaactacaaaaaattagccgggtgtggtggcaggcacctgtgatcccagctactca  940+600

         .         .         .         .         .         .
ggaggctgaggcaggagaatcgcttgaacccaggaggtggaggttgcagtgagccgggat  940+660

         .         .         .         .         .         .
cacaccattgcactccagcctgggtgacagagtgagactctgtctcaaaaaaaaaaaaaa  940+720

         .         .         .         .         .         .
aaaaaaaagcgaattctgaaatacatgaattcttttccttagatgcctgcttctgtcttg  940+780

         .         .         .         .         .         .
aggtttgttgttgttatttcgaaacagagtcttgctctgtcgctcaggctggagtgcagt  940+840

         .         .         .         .         .         .
ggcatgatcttggctcaccacaacctccggctcccaggttcaagcgattcttctgcctca  940+900

         .         .         .         .         .         .
gcctcctgagtagctgggattacagctgaatgccaccttgctgggctaatttttgtattt  940+960

         .         .         .         .         .         .
ttagtagagatggggtttcaccatgttggccaggctggcctcgaactcctgacctcgagt  940+1020

         .         .         .         .         .         .
gatctgcccgcctcctgaagtgctgggattacaggcgtgagccacctcgtcctggtgagg  940+1080

         .         .         .         .         .         .
gtttttttttttccccaaccctctgtggtggatactgaaagaccatattaggataactgt  940+1140

         .         .         .         .         .         .
acagtatagagaaggcagtggcaagttttctctgtcatataccagagtgggcttgggcat  940+1200

         .         .         .         .         .         .
ggtggcatactcctgtagtctcagctaatcaggaggctgaggaaggaggatcgcttgggc  940+1260

         .         .         .         .         .         .
ccaggagttggagactgtagtgagctgtgatcacaccaccacacttcaatctgggcaaca  940+1320

         .         .         .         .         .         .
gagcaagagaccctatctctaaaaaaaagtaagtatttcggacactgtgggccatacggt  940+1380

         .         .         .         .         .         .
ctctggtgcagtttctcaacatggctgttgggtgaacacaaccacgcacagaacgcaaac  940+1440

         .         .         .         .         .         .
caatacacgtggctgtgggcccagaaaatgttatttatggacacaaaaattggaatttca  940+1500

         .         .         .         .         .         .
tataactgttttgtgtcatgaaaatgatttccctttttatttttatttttcttctcaagt  940+1560

         
atttaaata  940+1569

--------------------- middle of intron ---------------------
                                                            
                                          941-1568  tgtaaaag  941-1561

.         .         .         .         .         .         
ccatttttaggcctggcaggatggttcacagctgtaatcccagcactttgggaggtcgag  941-1501

.         .         .         .         .         .         
gcgggaggatcacgaggtcaggagatcgagaccatcctggccaacacagtgaaaccccgt  941-1441

.         .         .         .         .         .         
ctctactaaaaatacaaaaaattaaccaggcttggtggcgcgcgtctgtagtcccagctg  941-1381

.         .         .         .         .         .         
ctcaggaggctgaggcaggagaatcgcttgaatgcaggaggcggaggttgtagtgagccg  941-1321

.         .         .         .         .         .         
aggttgcaccactgcactccagcctgagcgacagagtgagagtccgcctcaaacaaaaaa  941-1261

.         .         .         .         .         .         
atgtttgcccatgctggtcttgaactcctgggctcaagctatctgcctgccttggtctcc  941-1201

.         .         .         .         .         .         
caaagttctgggattacaggcatgagctacagcgcccggacttttgttgttttatatcta  941-1141

.         .         .         .         .         .         
tatatctatatataacttgttttatgtatatatataacttgttttatatatatacataaa  941-1081

.         .         .         .         .         .         
ctgcagtaaaaaacatgtaacataaaatttaccttctcaaaccttattaagtgcacagtt  941-1021

.         .         .         .         .         .         
ctgtgccattagcaaattcacactgttgtacaacatcacaaccaccatctccagaacttt  941-961

.         .         .         .         .         .         
tttttttttttttattctttttgagacagagtctcactcgtcgcacgggctggagtgcag  941-901

.         .         .         .         .         .         
tggtgcgatctcggttcactgcaacctccacctaccaggttcaagcaattctcctgcctc  941-841

.         .         .         .         .         .         
agccccctcagtagctgggattacaggtgcccgtcctaccacgcccagctaatttttgta  941-781

.         .         .         .         .         .         
ttttcagtagagactgactgggtttcaccatgttggccaggctggtctcgaactcctgac  941-721

.         .         .         .         .         .         
ctcaagtgatcctcccacctcagcctcccaaagtgctgggaatacaggcatgagccactg  941-661

.         .         .         .         .         .         
cgcccggccccagaactcttttatcttcccaaactgaagctctgtccccatgaaacactc  941-601

.         .         .         .         .         .         
actctccatcccctccccaactcctggcacccaccattctactttctgtccctatgaatg  941-541

.         .         .         .         .         .         
tgatggctctagggacctcctctgagtggaatcagacagcattttccttttttgactggc  941-481

.         .         .         .         .         .         
ttatttcactgagccaagtgcggtggcacacgcctgtaatcccaaaactttgggagaccg  941-421

.         .         .         .         .         .         
aggcgggcgcatcacctgaggtcaggagttcgagaccagcccggccaacatggtgaaacc  941-361

.         .         .         .         .         .         
ccatctctagtaaaaatacaaaaaattagcctgtcatggtcgtgggtgcctgtaatccca  941-301

.         .         .         .         .         .         
gctaagtgggaggctgaggcaggagaatcgcttgtacccaggaggcggaggtcgcagtga  941-241

.         .         .         .         .         .         
gccgagatcgtgccattacactccagcctgggcaacaagagtgaaactccgtctctccta  941-181

.         .         .         .         .         .         
aaaatacaaaaaaattagctgggcatggtggcacatgcctgtagtcccagctacttggga  941-121

.         .         .         .         .         .         
ggctgaggcaggagaatcacttgaacccgggaggtggaggttgtaatgagccaaggttgg  941-61

.         .         .         .         .         .         
cggcgaagggatgggtaggggcccgagagtgaccagtctgcatcccctggccctgcgcag  941-1


Powered by LOVDv.1.1.0 Build 12
©2004-2006 Leiden University Medical Center