low density lipoprotein receptor (LDLR) - 704 nt intron 05 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .
gtgagcgctggccatctggttttccatcccccattctctgtgccttgctgcttgcaaatg  817+60

         .         .         .         .         .         .
atttgtgaagccagagggcgcttccctggtcagctctgcaccagctgtgcgtctgtgggc  817+120

         .         .         .         .         .         .
aagtgacttgacttctcagagcctcacttccttttgttttgagacggagtctcgctctga  817+180

         .         .         .         .         .         .
cacccaggctggagtgctgtggcacaatcacagctcacggcagcctctgcctctgatgtc  817+240

         .         .         .         .         .         .
cagtgattctcctgcctcagcctcccgagtagctgagattaaaggcgtataccaccacgc  817+300

         .         .         .         .         .  
ccggctaattttttgtatttttattagagacagggtttctccatgttggcca  817+352

--------------------- middle of intron ---------------------
          .         .         .         .         .         
        ggctggtcttgaactcctggtctcaggtgatccacccgcctcggcctcccaa  818-301

.         .         .         .         .         .         
agtgctaggattacaggtgtgagccactgcgccaggcctaatttttttgtatttttagta  818-241

.         .         .         .         .         .         
gagatgcggttttgccatattgcccaggctggtctcgaactcctgggctcaagcgatctg  818-181

.         .         .         .         .         .         
cctgccttggcctcccaaagtgctgggattacaggcacaaaccaccgtgcccgacgcgtt  818-121

.         .         .         .         .         .         
ttcttaatgaatccatttgcatgcgttcttatgtgaataaactattatatgaatgagtgc  818-61

.         .         .         .         .         .         
caagcaaactgaggctcagacacacctgaccttcctccttcctctctctggctctcacag  818-1


Powered by LOVDv.1.1.0 Build 12
©2004-2006 Leiden University Medical Center