low density lipoprotein receptor (LDLR) - 2433 nt intron 03 reference sequence

(intronic numbering for coding DNA Reference Sequence)


         .         .         .         .         .         .
gtaagtgtggccctgcctttgctattgagcctatctgagtcctggggagtggtctgactt  313+60

         .         .         .         .         .         .
tgtctctacggggtcctgctcgagctgcaaggcagctgccccgaactgggctccatctct  313+120

         .         .         .         .         .         .
tgggggctcataccaagcctcttccgcccttcaaatccccccttgaccaggaggcattac  313+180

         .         .         .         .         .         .
aaagtggggatggtgctacctcttcgggtttgtcacgcacagtcagggaggctgtccctg  313+240

         .         .         .         .         .         .
ccgagggctagccacctggcacacacactggcaagccgctgtgattcccgctggtcgtga  313+300

         .         .         .         .         .         .
tccccgtgatcctgtgatccccgccccgtgaggctgaacacatagtgacgcttgctagcc  313+360

         .         .         .         .         .         .
aagcctcaatgacccacgtaacatgaagggggaaaagccagaaagttctgccaaggagca  313+420

         .         .         .         .         .         .
aggccaagaatcccgaagggaaatggactttgaagctgggcgtcttcttggctgtcttaa  313+480

         .         .         .         .         .         .
tacaagtggcacatccaaatccaaaaccccgaaattcaaagtcttgagcacccgaaattc  313+540

         .         .         .         .         .         .
tgaaacgtcttgagcactgacctttagaaggaaatgcttattggagcattttggatttcg  313+600

         .         .         .         .         .         .
gatttttaccactgagtgtggagtcctaattaggaaaaaaaccaggctgaccgaaccaaa  313+660

         .         .         .         .         .         .
ggaaagcaataaaagaaggcagatagggtcaggcacggtggctcacccctgtaatcccag  313+720

         .         .         .         .         .         .
ccttttgagaggctgaggcgggtggatcacttgaggtcaggagttcgagagcagcctggc  313+780

         .         .         .         .         .         .
caacacggtgaaaccccatctctactgaaaatacaaaaactagccaggtatggtggcgtc  313+840

         .         .         .         .         .         .
tgcctgtaatcccagctactcgggaggctgagacaggagaatcacttgaacctgggaggc  313+900

         .         .         .         .         .         .
agaggttgcagtgagccaatatcacgccattgcactccagcctgggggacaagagcgaaa  313+960

         .         .         .         .         .         .
ttctgtctcaaaaaaaaagaagaagaaggccgacaaactatgtaactctgcctttctcca  313+1020

         .         .         .         .         .         .
tggtccagaacacacagccctcctgcgtaaataactccttatcttcctgctcccagctat  313+1080

         .         .         .         .         .         .
catcagacacctcggctgatagaaaattgcaagttagctcactgcaacctcggcattata  313+1140

         .         .         .         .         .         .
agtactgcacaaagccctcttcagcgcacagcacaagcaccattctataaaatctccagc  313+1200

         .       
aagcggccaggtgcagt  313+1217

--------------------- middle of intron ---------------------
                                                  .         
                                  314-1216  ggctcatacctgtaat  314-1201

.         .         .         .         .         .         
cccagcattttgggagactgaggcgggcggatcacctgaggtcaggagtttgagaccagc  314-1141

.         .         .         .         .         .         
ctggccaacatggtgaaaccccgtctctattaaaaatacaaaaaaattagccaggcgtgg  314-1081

.         .         .         .         .         .         
tggcaggtgcctgtaatcccagctacttggaaggctgaggcaggagaatcgcttgaaccc  314-1021

.         .         .         .         .         .         
gggaggtggaagttgcagtgagccgagatcttgccatcgcactccagcctgggggacaag  314-961

.         .         .         .         .         .         
agtgagacttcgtctcaaaaaaaaaaaaaaaaattcccagcaagcctttgtcttctggca  314-901

.         .         .         .         .         .         
gtcagctcctctcttgctgacctgctcattgctttcttgcaaggtattttcctacctact  314-841

.         .         .         .         .         .         
ttctggaataaatctgtctttctgtacttacaactaccttttttaaaatttctttctttt  314-781

.         .         .         .         .         .         
ttgagatggagtctcactctgtttgcccaggctggagttcagtggtgcaatctcagctca  314-721

.         .         .         .         .         .         
ctgcaacctctacctactgggttcaagcgattctcctgcctcagcttcccgagtagctgg  314-661

.         .         .         .         .         .         
gattacaggcgtgcaccagcacgcaggctaatttttgtatttttagtagagacggggttt  314-601

.         .         .         .         .         .         
caccatgttggccaaggtggtcttgaactcctgacctcaagtgatcctcccacctcagcc  314-541

.         .         .         .         .         .         
tcccaaagcgctaggattacggccatgagccactgaggccggctgcacctacaactgtct  314-481

.         .         .         .         .         .         
tgataaattcttacccccacaccactggtccagatagtcagtgctcacccacaacattaa  314-421

.         .         .         .         .         .         
ggatattccaaatttgaaacattccaaaatcagaaaaatattccaactctgaaaatattc  314-361

.         .         .         .         .         .         
caaaatccaaaaaaattcaaaatccaaaacacttctggtcccaagcattttagagaaggg  314-301

.         .         .         .         .         .         
atactcaacccaaaataaggacagcaattctataaattgtgctaccatcttgcaggtctc  314-241

.         .         .         .         .         .         
agtttaacagctttacacctattagcgcaccagtgctcatagcagtgctgggaaatgtgt  314-181

.         .         .         .         .         .         
acagatgaggaaactgaggcaccgagagggcagtggttcagagtccatggcccctgactg  314-121

.         .         .         .         .         .         
ctccccagcccgcctttccaggggcctggcctcactgcggcagcgtccccggctatagaa  314-61

.         .         .         .         .         .         
tgggctggtgttgggagacttcacacggtgatggtggtctcggcccatccatccctgcag  314-1


Powered by LOVDv.1.1.0 Build 12
©2004-2006 Leiden University Medical Center