low density lipoprotein receptor (LDLR) - coding DNA reference sequence

(used for mutation description)

(last modified July 30, 2006)


Please note that introns are available by clicking on the exon numbers above the sequence.
 (upstream sequence)
                                                   .         
                                                   ccagggtttc       -61

 .         .         .         .         .         .         
 cagctaggacacagcaggtcgtgatccgggtcgggacactgcctggcagaggctgcgagc       -1

          .         .         .         .         .         .
 ATGGGGCCCTGGGGCTGGAAATTGCGCTGGACCGTCGCCTTGCTCCTCGCCGCGGCGGGG        60
 M  G  P  W  G  W  K  L  R  W  T  V  A  L  L  L  A  A  A  G          20

         | 2 .         .         .         .         .         .
 ACTGCAG | TGGGCGACAGATGCGAAAGAAACGAGTTCCAGTGCCAAGACGGGAAATGCATC     120
 T  A  V |   G  D  R  C  E  R  N  E  F  Q  C  Q  D  G  K  C  I       40

          .         .         .         .         .         .
 TCCTACAAGTGGGTCTGCGATGGCAGCGCTGAGTGCCAGGATGGCTCTGATGAGTCCCAG        180
 S  Y  K  W  V  C  D  G  S  A  E  C  Q  D  G  S  D  E  S  Q          60

          . | 3        .         .         .         .         .
 GAGACGTGCT | TGTCTGTCACCTGCAAATCCGGGGACTTCAGCTGTGGGGGCCGTGTCAAC     240
 E  T  C  L |   S  V  T  C  K  S  G  D  F  S  C  G  G  R  V  N       80

          .         .         .         .         .         .
 CGCTGCATTCCTCAGTTCTGGAGGTGCGATGGCCAAGTGGACTGCGACAACGGCTCAGAC        300
 R  C  I  P  Q  F  W  R  C  D  G  Q  V  D  C  D  N  G  S  D          100

          .    | 4     .         .         .         .         .
 GAGCAAGGCTGTC | CCCCCAAGACGTGCTCCCAGGACGAGTTTCGCTGCCACGATGGGAAG     360
 E  Q  G  C  P |   P  K  T  C  S  Q  D  E  F  R  C  H  D  G  K       120

          .         .         .         .         .         .
 TGCATCTCTCGGCAGTTCGTCTGTGACTCAGACCGGGACTGCTTGGACGGCTCAGACGAG        420
 C  I  S  R  Q  F  V  C  D  S  D  R  D  C  L  D  G  S  D  E          140

          .         .         .         .         .         .
 GCCTCCTGCCCGGTGCTCACCTGTGGTCCCGCCAGCTTCCAGTGCAACAGCTCCACCTGC        480
 A  S  C  P  V  L  T  C  G  P  A  S  F  Q  C  N  S  S  T  C          160

          .         .         .         .         .         .
 ATCCCCCAGCTGTGGGCCTGCGACAACGACCCCGACTGCGAAGATGGCTCGGATGAGTGG        540
 I  P  Q  L  W  A  C  D  N  D  P  D  C  E  D  G  S  D  E  W          180

          .         .         .         .         .         .
 CCGCAGCGCTGTAGGGGTCTTTACGTGTTCCAAGGGGACAGTAGCCCCTGCTCGGCCTTC        600
 P  Q  R  C  R  G  L  Y  V  F  Q  G  D  S  S  P  C  S  A  F          200

          .         .         .         .         .         .
 GAGTTCCACTGCCTAAGTGGCGAGTGCATCCACTCCAGCTGGCGCTGTGATGGTGGCCCC        660
 E  F  H  C  L  S  G  E  C  I  H  S  S  W  R  C  D  G  G  P          220

          .         .         .     | 5    .         .         .
 GACTGCAAGGACAAATCTGACGAGGAAAACTGCG | CTGTGGCCACCTGTCGCCCTGACGAA     720
 D  C  K  D  K  S  D  E  E  N  C  A |   V  A  T  C  R  P  D  E       240

          .         .         .         .         .         .
 TTCCAGTGCTCTGATGGAAACTGCATCCATGGCAGCCGGCAGTGTGACCGGGAATATGAC        780
 F  Q  C  S  D  G  N  C  I  H  G  S  R  Q  C  D  R  E  Y  D          260

          .         .         .        | 6 .         .         .
 TGCAAGGACATGAGCGATGAAGTTGGCTGCGTTAATG | TGACACTCTGCGAGGGACCCAAC     840
 C  K  D  M  S  D  E  V  G  C  V  N  V |   T  L  C  E  G  P  N       280

          .         .         .         .         .         .
 AAGTTCAAGTGTCACAGCGGCGAATGCATCACCCTGGACAAAGTCTGCAACATGGCTAGA        900
 K  F  K  C  H  S  G  E  C  I  T  L  D  K  V  C  N  M  A  R          300

          .         .         .         . | 7        .         .
 GACTGCCGGGACTGGTCAGATGAACCCATCAAAGAGTGCG | GGACCAACGAATGCTTGGAC     960
 D  C  R  D  W  S  D  E  P  I  K  E  C  G |   T  N  E  C  L  D       320

          .         .         .         .         .         .
 AACAACGGCGGCTGTTCCCACGTCTGCAATGACCTTAAGATCGGCTACGAGTGCCTGTGC        1020
 N  N  G  G  C  S  H  V  C  N  D  L  K  I  G  Y  E  C  L  C          340

          .         .         .         . | 8        .         .
 CCCGACGGCTTCCAGCTGGTGGCCCAGCGAAGATGCGAAG | ATATCGATGAGTGTCAGGAT     1080
 P  D  G  F  Q  L  V  A  Q  R  R  C  E  D |   I  D  E  C  Q  D       360

          .         .         .         .         .         .
 CCCGACACCTGCAGCCAGCTCTGCGTGAACCTGGAGGGTGGCTACAAGTGCCAGTGTGAG        1140
 P  D  T  C  S  Q  L  C  V  N  L  E  G  G  Y  K  C  Q  C  E          380

          .         .         .         .       | 9  .         .
 GAAGGCTTCCAGCTGGACCCCCACACGAAGGCCTGCAAGGCTGTGG | GCTCCATCGCCTAC     1200
 E  G  F  Q  L  D  P  H  T  K  A  C  K  A  V  G |   S  I  A  Y       400

          .         .         .         .         .         .
 CTCTTCTTCACCAACCGGCACGAGGTCAGGAAGATGACGCTGGACCGGAGCGAGTACACC        1260
 L  F  F  T  N  R  H  E  V  R  K  M  T  L  D  R  S  E  Y  T          420

          .         .         .         .         .         .
 AGCCTCATCCCCAACCTGAGGAACGTGGTCGCTCTGGACACGGAGGTGGCCAGCAATAGA        1320
 S  L  I  P  N  L  R  N  V  V  A  L  D  T  E  V  A  S  N  R          440

          .         .         .         | 10         .         .
 ATCTACTGGTCTGACCTGTCCCAGAGAATGATCTGCAG | CACCCAGCTTGACAGAGCCCAC     1380
 I  Y  W  S  D  L  S  Q  R  M  I  C  S  |  T  Q  L  D  R  A  H       460

          .         .         .         .         .         .
 GGCGTCTCTTCCTATGACACCGTCATCAGCAGAGACATCCAGGCCCCCGACGGGCTGGCT        1440
 G  V  S  S  Y  D  T  V  I  S  R  D  I  Q  A  P  D  G  L  A          480

          .         .         .         .         .         .
 GTGGACTGGATCCACAGCAACATCTACTGGACCGACTCTGTCCTGGGCACTGTCTCTGTT        1500
 V  D  W  I  H  S  N  I  Y  W  T  D  S  V  L  G  T  V  S  V          500

          .         .         .         .         .         .
 GCGGATACCAAGGGCGTGAAGAGGAAAACGTTATTCAGGGAGAACGGCTCCAAGCCAAGG        1560
 A  D  T  K  G  V  K  R  K  T  L  F  R  E  N  G  S  K  P  R          520

          .         .       | 11 .         .         .         .
 GCCATCGTGGTGGATCCTGTTCATGG | CTTCATGTACTGGACTGACTGGGGAACTCCCGCC     1620
 A  I  V  V  D  P  V  H  G  |  F  M  Y  W  T  D  W  G  T  P  A       540

          .         .         .         .         .         .
 AAGATCAAGAAAGGGGGCCTGAATGGTGTGGACATCTACTCGCTGGTGACTGAAAACATT        1680
 K  I  K  K  G  G  L  N  G  V  D  I  Y  S  L  V  T  E  N  I          560

          .         .      | 12  .         .         .         .
 CAGTGGCCCAATGGCATCACCCTAG | ATCTCCTCAGTGGCCGCCTCTACTGGGTTGACTCC     1740
 Q  W  P  N  G  I  T  L  D |   L  L  S  G  R  L  Y  W  V  D  S       580

          .         .         .         .         .         .
 AAACTTCACTCCATCTCAAGCATCGATGTCAACGGGGGCAACCGGAAGACCATCTTGGAG        1800
 K  L  H  S  I  S  S  I  D  V  N  G  G  N  R  K  T  I  L  E          600

          .         .         .         .      | 13  .         .
 GATGAAAAGAGGCTGGCCCACCCCTTCTCCTTGGCCGTCTTTGAG | GACAAAGTATTTTGG     1860
 D  E  K  R  L  A  H  P  F  S  L  A  V  F  E   | D  K  V  F  W       620

          .         .         .         .         .         .
 ACAGATATCATCAACGAAGCCATTTTCAGTGCCAACCGCCTCACAGGTTCCGATGTCAAC        1920
 T  D  I  I  N  E  A  I  F  S  A  N  R  L  T  G  S  D  V  N          640

          .         .         .         .         .         .
 TTGTTGGCTGAAAACCTACTGTCCCCAGAGGATATGGTTCTCTTCCACAACCTCACCCAG        1980
 L  L  A  E  N  L  L  S  P  E  D  M  V  L  F  H  N  L  T  Q          660

         | 14.         .         .         .         .         .
 CCAAGAG | GAGTGAACTGGTGTGAGAGGACCACCCTGAGCAATGGCGGCTGCCAGTATCTG     2040
 P  R  G |   V  N  W  C  E  R  T  T  L  S  N  G  G  C  Q  Y  L       680

          .         .         .         .         .         .
 TGCCTCCCTGCCCCGCAGATCAACCCCCACTCGCCCAAGTTTACCTGCGCCTGCCCGGAC        2100
 C  L  P  A  P  Q  I  N  P  H  S  P  K  F  T  C  A  C  P  D          700

          .         .         .         . | 15       .         .
 GGCATGCTGCTGGCCAGGGACATGAGGAGCTGCCTCACAG | AGGCTGAGGCTGCAGTGGCC     2160
 G  M  L  L  A  R  D  M  R  S  C  L  T  E |   A  E  A  A  V  A       720

          .         .         .         .         .         .
 ACCCAGGAGACATCCACCGTCAGGCTAAAGGTCAGCTCCACAGCCGTAAGGACACAGCAC        2220
 T  Q  E  T  S  T  V  R  L  K  V  S  S  T  A  V  R  T  Q  H          740

          .         .         .         .         .         .
 ACAACCACCCGACCTGTTCCCGACACCTCCCGGCTGCCTGGGGCCACCCCTGGGCTCACC        2280
 T  T  T  R  P  V  P  D  T  S  R  L  P  G  A  T  P  G  L  T          760

          .         .         .  | 16      .         .         .
 ACGGTGGAGATAGTGACAATGTCTCACCAAG | CTCTGGGCGACGTTGCTGGCAGAGGAAAT     2340
 T  V  E  I  V  T  M  S  H  Q  A |   L  G  D  V  A  G  R  G  N       780

          .         .         .         .          | 17        .
 GAGAAGAAGCCCAGTAGCGTGAGGGCTCTGTCCATTGTCCTCCCCATCG | TGCTCCTCGTC     2400
 E  K  K  P  S  S  V  R  A  L  S  I  V  L  P  I  V |   L  L  V       800

          .         .         .         .         .         .
 TTCCTTTGCCTGGGGGTCTTCCTTCTATGGAAGAACTGGCGGCTTAAGAACATCAACAGC        2460
 F  L  C  L  G  V  F  L  L  W  K  N  W  R  L  K  N  I  N  S          820

          .         .         .         .         .         .
 ATCAACTTTGACAACCCCGTCTATCAGAAGACCACAGAGGATGAGGTCCACATTTGCCAC        2520
 I  N  F  D  N  P  V  Y  Q  K  T  T  E  D  E  V  H  I  C  H          840

          .         .        | 18.         .         .         .
 AACCAGGACGGCTACAGCTACCCCTCG | AGACAGATGGTCAGTCTGGAGGATGACGTGGCG     2580
 N  Q  D  G  Y  S  Y  P  S   | R  Q  M  V  S  L  E  D  D  V  A       860

    
 TGA                                                                 2583
 X                                                                   860

          .         .         .         .         .         .
 acatctgcctggagtcccgtccctgcccagaacccttcctgagacctcgccggccttgtt        *60

          .         .         .         .         .         .
 ttattcaaagacagagaagaccaaagcattgcctgccagagctttgttttatatatttat        *120

          .         .         .         .         .         .
 tcatctgggaggcagaacaggcttcggacagtgcccatgcaatggcttgggttgggattt        *180

          .         .         .         .         .         .
 tggtttcttcctttcctcgtgaaggataagagaaacaggcccggggggaccaggatgaca        *240

          .         .         .         .         .         .
 cctccatttctctccaggaagttttgagtttctctccaccgtgacacaatcctcaaacat        *300

          .         .         .         .         .         .
 ggaagatgaaaggggaggggatgtcaggcccagagaagcaagtggctttcaacacacaac        *360

          .         .         .         .         .         .
 agcagatggcaccaacgggaccccctggccctgcctcatccaccaatctctaagccaaac        *420

          .         .         .         .         .         .
 ccctaaactcaggagtcaacgtgtttacctcttctatgcaagccttgctagacagccagg        *480

          .         .         .         .         .         .
 ttagcctttgccctgtcacccccgaatcatgacccacccagtgtctttcgaggtgggttt        *540

          .         .         .         .         .         .
 gtaccttccttaagccaggaaagggattcatggcgtcggaaatgatctggctgaatccgt        *600

          .         .         .         .         .         .
 ggtggcaccgagaccaaactcattcaccaaatgatgccacttcccagaggcagagcctga        *660

          .         .         .         .         .         .
 gtcactggtcacccttaatatttattaagtgcctgagacacccggttaccttggccgtga        *720

          .         .         .         .         .         .
 ggacacgtggcctgcacccaggtgtggctgtcaggacaccagcctggtgcccatcctccc        *780

          .         .         .         .         .         .
 gacccctacccacttccattcccgtggtctccttgcactttctcagttcagagttgtaca        *840

       
 ctgtgt                                                              *846

 (downstream sequence)
Legend:
Nucleotide numbering (following the rules of the HGVS for a 'Coding DNA Reference Sequence') is indicated at the right of the sequence, counting the A of the ATG translation initiating Methionine as 1. Every 10th nucleotide is indicated by a "." above the sequence. The Low density lipoprotein receptor protein sequence is shown below the coding DNA sequence, with numbering indicated at the right starting with 1 for the translation initiating Methionine. Every 10th amino acid is shown in bold. The position of introns is indicated by a vertical line, splitting the two exons. The start of the first exon (transcription initiation site) is indicated by a '\', the end of the last exon (poly-A addition site) by a '/'. The exon number is indicated above the first nucleotide(s) of the exon. To aid the description of frame shift mutations, all stop codons in the +1 frame are shown in bold while all stop codons in the +2 frame are underlined.

Powered by LOVDv.1.1.0 Build 12
©2004-2006 Leiden University Medical Center