UCL Cancer Institute

NKI Cancer Specific pRetroSuperCam shRNA library


Individual hairpin clones


Formats


Individual hairpins come as either bacterial agar stab cultures, high quality DNA ready for transfection or lentiviral particles ready for transduction.

  • Bacterial stab cultures: You will need to re-streak the bacteria from the surface of the culture onto an LB-Amp plate, pick a single colony, grow, prepare and purify your plasmid DNA using a kit and sequence the DNA to make sure the sequence is correct. The DNA is then ready for transfection.

  • High quality DNA: Your hairpins will come as a high quality DNA mini or maxi-prep that has been sequence confirmed and is ready for transfection. You will also be provided with a glycerol stock, sequence comparison and quality metrics of your DNA prep.

  • Retroviral particles: Your hairpins will come as retroviral particles in culture media, either concentrated or unconconcentrated depending on your requirements, that is ready for transduction of your cell type of interest. This will have been titered on 293T and can also be titered on your cell type of interest if required. You will also be provided with the remaining high quality DNA mini or maxi-prep, a glycerol stock, sequence comparison and quality metrics of your DNA prep.

Controls


We have one negative control for the Human pRSC library.

  • Negative:
    • Empty pRSC vector

Controls are the same price as the shRNA hairpins and can be ordered using the order form below

UCL Consortium prices


This includes members of the UCL Cancer Institute, Institute of Child Health, Institute of Neurology and the Division of Infection and Immunity.

Bacterial stab cultures £15.00

High quality DNA  
miniprep £55.00
maxiprep £85.00

Retroviral particles unconcentrated (15ml)

concentrated (1ml)

with miniprep £195.00 £265.00
with maxiprep £225.00 £295.00

* Viral particles are titrated on 293T cells. Please contact us if you would like your viral particles titered on an alternate cell type also.

** Viral particles are provided in DMEM (unconcentrated) and Optimem (concentrated). If you would like your virus in alternative media this can be arranged.

*** Please contact us directly for any further requests.

Ordering clones

 

Instructions:

  • Download the ordering form and NKI library database of available hairpins below.
  • Search the excel file for your gene of interest using gene names or accession numbers.
  • Blast the hairpin sense sequence to confirm the hairpin targets your gene of interest and no other genes
  • Take note of the Clone Product code for the hairpins you would like
  • If you are not from within the Cancer Institute, please arrange an eIDT assigned to Catherine King at the Cancer Institute to cover the cost of the order. Refer to the price list above or if you are unsure please contact us
  • Complete the ordering form:
      • Make sure you enter your grant code (CI users) or eIDT number (all other users)
      • Indicate whether you would like the control and what format you would like
      • List the the Clone Product code of the hairpins you are after. These codes will start with HNRCLO.
  • Email your completed form to rnai@cancer.ucl.ac.uk.
  • We will contact you to let you know your order has been received and to arrange collection. All clones are collected from the UCL Cancer Institute, Paul O'Gorman Building on Huntley St.
NKI Order Form
NKI Library Database



Sequencing your hairpins


We highly recommend sequencing your hairpins before starting work with them.

  • H1 primer: (pRetroSuperCam hairpins) 5’ TGGCAGGAAGATGGCTGTGA 3’ The binding site for this primer is base 2378-2397 and runs in reverse complement direction.
  •  

    Contacts


    Catherine King
    0207-679-6506
    catherine.king@ucl.ac.uk