UCL Cancer Institute

FAQS



What is RNAi?


RNAi is a normal cellular function which has been manipulated to allow researchers to specifically silence genes of interest for study. RNAi is a natural defence mechanism whereby the cell protects itself against dsRNA which may be a virus or transposable element. The introduction of dsRNA into the cytoplasm of a host cell initiates an endogenous chain of processing events which leads to sequence specific targeting and subsequent silencing of DNA.


Which library should I choose; the Thermo Scientific GIPZ or NKI pRSC library? What is the difference between them?


Both our libraries are Human shRNA vector libraries. The major differences between these libraries are:

  • The GIPZ library hairpins are transcribed from a Pol II promoter whearas pRCS hairpins are transcribed from a Pol III promoter.
  • The GIPZ library has a TurboGFP reporter translated alongside the hairpins which allows visualization of cells expressing a hairpin.
  • The pRSCplasmid is smaller (~7.1kb) than the GIPZ vector (~11.7kb) which may be important if transfecting into difficult to transfect cells.
  • The pRSC library is smaller (13,000 clones) compared to the GIPZ library (currently ~90,000). The pRSC library is specifically focused on a specific cancer related set of genes whereas the GIPZ library is whole genome.

The choice as to which library you choose depends on the above factors and which particular library contains clones targeting your genes of interest. It can also be a good idea to use clones from both libraries for the same gene where possible as a form of verification control.


How long will it take to obtain my clones?


We are currently providing customers with bacterial within 1-2 days of an order being placed. DNA will take approximately 5 working days and viral preps approximately 3-4weeks. This, however, will depend on the current workload and number of clones you order.


Can I obtain the control hairpins?


Yes we have the control hairpins for the libraries. See the Individual Hairpin Ordering section for the library you are interested in to obtain more details about these.

What bacteria are my clones contained in?


For the GIPZ library:

The bacterial strain is an E.coli strain called PrimePlus. You can find out more about this bacteria in the PDF.

For the pRSC library:

The bacterial strain is an E.coli strain called DH5alpha. The genotype for this strain is fhuA2 Δ (argF-lacZ)U169 phoA glnV44 F80 Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17.


What media should I use to grow my clones?


You should use the low salt LB broth.

2X-LB broth (low salt) media preparation:

LB-Broth-Lennox 20 g/L VWR 1.10285.0500
Peptone 10g/L VWR 1.07213.1000
Yeast extract 5g/L VWR 1.03753.0500



What antibiotics should I use in my media when growing my bacteria?


In the media to grow both pGIPZ and pRSC library hairpins you should use ampicillin (carbenicillin).

Carbenicillin 100 µg/ml Sigma C1613
    OR  
Yeast extract 100 µg/ml Melford Labs Ltd C0109


In the media for the pRSC library clones you should also include Chloramphenicol.

Chloramphenicol 30 µg/ml Melford Labs Ltd C0113


In the glycerol stocks for long term storage of pGIPZ hairpins ONLY you should also include Zeocin. Do NOT inlcude zeocin in the media for normal plasmid propagation preparations as it will reduce the yield of DNA. Do NOT include zeocin in the glycerol stocks of pRSC plasmids.

Zeocin 25 µg/ml AutogenBioclear UK Ltd ANT-ZN-1



What plasmid preparation kit is used to prepare my plasmid DNA?


You can use any high quality commercial plasmid preparation kit to prepare your DNA. We use the Qiagen Maxi prep kit catalogue #12163 as it produces high quality DNA for transfection.


How do I check the quality of my DNA?


You should use a nanodrop to check the quality of your DNA. There is a nanodrop within the Cancer Institute that you can use if you use the sequencing service listed below.


How do I go about sequencing my plasmid?


Scientific Support Services has a drop-off for sequencing within the Cancer Institute and ICH and will sequence the hairpins for £6 each.

I have also already provided them with the appropriate primers so you only need to submit the DNA and label whether it is a GIPZ or pRSC hairpin and whether to use the GIPZ or H1 primers respectively. For more information see our DNA sequencing page

If you wish to sequence your own DNA, you should use the primers:

GIPZ primer: (pGIPZ hairpins)
5' - GCATTAAAGCAGCGTATC - 3'      Melting Temp: 52.7c
The binding site for this primer is base 5820-5842 and runs in reverse complement direction.

H1 primer: (pRetroSuperCam hairpins)
5’ TGGCAGGAAGATGGCTGTGA 3’
The binding site for this primer is base 2378-2397 and runs in reverse complement direction.


What is the sequence of the GIPZ non-silencing, GAPDH and EG5 GIPZ control hairpins?


GAPDH

22mer: cCCTCATTTCCTGGTATGACAA

Sequence with the regulatory regions included:
TGCTGTTGACAGTGAGCGCCCTCATTTCCTGGTATGACAATAGTGAAGCCACAGATGTATTGTCATACCAGGAAATGAGGTTGCCTACTGCCTCGGA

Non-silencing: (This sequence does not match any known mammalian genes)

22mer: aTCTCGCTTGGGCGAGAGTAAG

Sequence with the regulatory regions included:
TGCTGTTGACAGTGAGCGATCTCGCTTGGGCGAGAGTAAGTAGTGAAGCCACAGATGTACTTACTCTCGCCCAAGCGAGAGTGCCTACTGCCTCGGA

EG5 Sequence: (targets human NOT mouse)

22mer: cGGCCATGCTAGAAGTACATAA

Sequence with the regulatory regions included:
TGCTGTTGACAGTGAGCGCGGCCATGCTAGAAGTACATAATAGTGAAGCCACAGATGTATTATGTACTTCTAGCATGGCCTTGCCTACTGCCTCGGA

Aligns to:
NM_004523.2 Homo sapiens kinesin family member 11 (KIF11), mRNA

Length=4908


Where can I find the sequence of my RNAi hairpin?


You can find the sequence of your clones within the library database excel files that are found in the Individual Hairpin Ordering section for each library. For GIPZ hairpins, you can also find this information on the Thermo Scientific website.


 

Contacts


Catherine King
0207-679-6506
catherine.king@ucl.ac.uk

Jacob Raby
0207-679-6795
j.raby@ucl.ac.uk